Indice del forum Olimpo Informatico
I Forum di Zeus News
Leggi la newsletter gratuita - Attiva il Menu compatto
 
 FAQFAQ   CercaCerca   Lista utentiLista utenti   GruppiGruppi   RegistratiRegistrati 
 ProfiloProfilo   Messaggi privatiMessaggi privati   Log inLog in 

    Newsletter RSS Facebook Twitter Contatti Ricerca
10 anni di galera per foto osé a ultrasessantenni consenzien
Nuovo argomento   Rispondi    Indice del forum -> Sessualità e cultura
Precedente :: Successivo  
Autore Messaggio
Zeus News
Ospite





MessaggioInviato: 05 Mag 2009 23:09    Oggetto: 10 anni di galera per foto osé a ultrasessantenni consenzien Rispondi citando

Commenti all'articolo 10 anni di galera per foto osé a ultrasessantenni consenzienti
Una legge in discussione in America vuole vietare le foto scattate con "intenti lascivi" a soggetti che hanno più di 60 anni.


Foto di Diana Lundin
Top
mariantonio.inter
Semidio
Semidio


Registrato: 02/06/07 14:56
Messaggi: 478
Residenza: meglio nero che bianconero ! NO al razzimo

MessaggioInviato: 06 Mag 2009 08:44    Oggetto: né censura, né incompetenza, né leggerezza ma protezione Rispondi citando

forse è solo un mezzo per proteggere le persone anziane, allettate da soldi facili perchè magari indigenti. Oppure persone anziane circuite. Mi sembra che, per dire, dopo i 70, mostrarsi nudo o a letto con la moglie, no sia uno spettacolo interessante se non npon per guardoni, pervertiti e malati cronici di video porno.
Quindi non condivido la conclusione dell'articolo: nè censura, nè incompetenza, nè leggerezza ma solo il proteggere una fascia che, e qui siamo tutti d'accordo, è, assieme ai bambini, la più debole.
saluti
Top
Profilo Invia messaggio privato
Zeus
Amministratore
Amministratore


Registrato: 21/10/00 01:01
Messaggi: 12708
Residenza: San Junipero

MessaggioInviato: 06 Mag 2009 10:29    Oggetto: Rispondi citando

Ammesso che sia come dici tu, allora avrebbe senso (eventualmente) andare a caccia di chi queste foto le diffonde. Anche se mi risulta quanto meno curioso che, secondo questo ragionamento, le foto porno di un trentenne possano circolare tranquillamente e quelle di un sessantenne no.

Ma il punto non è solo questo. Ti sembra corretto che si prospetti una pena detentiva di 10 anni per chi, nell'intimità della propria casa, scatti una foto in intimità al proprio partner ultrasessantenne?
Top
Profilo Invia messaggio privato HomePage
joker87
Eroe in grazia degli dei
Eroe in grazia degli dei


Registrato: 23/05/08 08:32
Messaggi: 166

MessaggioInviato: 06 Mag 2009 10:32    Oggetto: e la ragazzina denunciata per pedopornografia? Rispondi citando

zeussino ha scritto:
Ammesso che sia come dici tu, allora avrebbe senso (eventualmente) andare a caccia di chi queste foto le diffonde. Anche se mi risulta quanto meno curioso che, secondo questo ragionamento, le foto porno di un trentenne possano circolare tranquillamente e quelle di un sessantenne no.

Ma il punto non è solo questo. Ti sembra corretto che si prospetti una pena detentiva di 10 anni per chi, nell'intimità della propria casa, scatti una foto in intimità al proprio partner ultrasessantenne?


Ti ricordo che proprio su ZN, qualche mese fa avevate parlato di una ragazzina denunciata per pedopornografia perchè aveva diffuso delle SUE foto osè... Non mi stupisce troppo quindi una legge simile (seppur la ritengo comunque una cag***!
Top
Profilo Invia messaggio privato
Puppybarf
Semidio
Semidio


Registrato: 17/10/05 10:22
Messaggi: 206
Residenza: Benevento

MessaggioInviato: 06 Mag 2009 10:32    Oggetto: a me sembra semplicemente mostruoso Rispondi citando

Niente da dire sui disabili mentali, ovviamente; ma limitare per legge la libertà di anziani consenzienti e nel pieno possesso delle proprie facoltà mentali a me sembra semplicemente mostruoso.
Top
Profilo Invia messaggio privato HomePage Yahoo MSN
Zeus
Amministratore
Amministratore


Registrato: 21/10/00 01:01
Messaggi: 12708
Residenza: San Junipero

MessaggioInviato: 06 Mag 2009 10:36    Oggetto: Rispondi citando

joker87 ha scritto:
Ti ricordo che proprio su ZN, qualche mese fa avevate parlato di una ragazzina denunciata per pedopornografia perchè aveva diffuso delle SUE foto osè... Non mi stupisce troppo quindi una legge simile (seppur la ritengo comunque una cag***!


In my humble opinion, faresti meglio prima a indignarti e poi a non stupirti, anziché il viceversa Wink
Top
Profilo Invia messaggio privato HomePage
mariantonio.inter
Semidio
Semidio


Registrato: 02/06/07 14:56
Messaggi: 478
Residenza: meglio nero che bianconero ! NO al razzimo

MessaggioInviato: 06 Mag 2009 10:51    Oggetto: preferisco la Arcuri a una settantenne Rispondi citando

caro zeussino, andare a caccia di chi fa le foto nella rete è come andare a caccia dei terroristi che usano la rete: forse sarebbe fattibile ma ci vorrebbero risorse spropositate (ricordo "casualmente" che le risorse pubbliche le paghiamo noi o comunque chi paga le tasse.......).
Poi, se permetti, la vista e il gusto, come dice non a caso il proverbio, "vogliono la loro parte". Quindi io preferisco un calendario della Arcuri alla foto di una settantenne in posizioni da Kamasutra! Altrimenti potremmo depennare la parola "decenza".
Per la pena, se fa le foto e se le tiene, no ma se fa le foto e le diffonde in internet per protagonismo, o peggio, le vende, SI.
ciao
Top
Profilo Invia messaggio privato
Silent Runner
Supervisor sezione Chiacchiere a 360°
Supervisor sezione Chiacchiere a 360°


Registrato: 16/05/05 09:17
Messaggi: 20629
Residenza: Pianeta Terra

MessaggioInviato: 06 Mag 2009 11:43    Oggetto: Aspetta di avere sessant'anni Rispondi citando

mariantonio.inter ha scritto:
caro zeussino, andare a caccia di chi fa le foto nella rete è come andare a caccia dei terroristi che usano la rete: forse sarebbe fattibile ma ci vorrebbero risorse spropositate (ricordo "casualmente" che le risorse pubbliche le paghiamo noi o comunque chi paga le tasse.......).
Poi, se permetti, la vista e il gusto, come dice non a caso il proverbio, "vogliono la loro parte". Quindi io preferisco un calendario della Arcuri alla foto di una settantenne in posizioni da Kamasutra! Altrimenti potremmo depennare la parola "decenza".
Per la pena, se fa le foto e se le tiene, no ma se fa le foto e le diffonde in internet per protagonismo, o peggio, le vende, SI.
ciao

In linea di massima si può anche essere d'accordo su qualcuna delle cose che affermi salvo sull'accontentarti di guardare la Arcuri su un calendario. Le foto di una sessantenne che esegue posture di kamasustra possono essere bizzarre e fastidiose ma aspetta di avere 60 anni e di sentirti perfettamente a tuo agio nel tuo corpo invecchiato. Le sessantenni non dovrebbero guardarsi allo specchio? E le giovani donne che non sono così belle quanto la Arcuri? E i giovani uomini che non hanno un corpo da tronista?

Mi sembra che la critica che si può fare ad una legge del genere è che sia discriminante nei confronti delle persone, in base all'età e per mere questioni di gusto personale.
La parola decenza è una parola che ben si adatta a qualsiasi criterio e i criteri cambiano nel tempo e nelle culture.
Perché dunque parlare del proprio gusto personale imponendolo agli altri per legge?
A me queste discriminazioni sulla base di criteri estetici non piacciono.
Se cominciamo a discriminare la visione di immagini solo perché rappresentano una categoria invece che un'altra finiamo per scivolare in una sorta di "razzismo" ingiustificabile da ogni punto di vista. Vietiamo di fotografare i disabili? I diversi, gli strani? I troppo magri? I troppo alti, i troppo pallidi, i troppo diversi da quello che vorremo vedere su un calendario?
Le straordinarie fotografie dei Freaks immortalate dalla grandissima Diane Arbus, immagini inquietanti di una umanità complessa e ricchissima ma totalmente ignorata dove le buttiamo? Nel cesso? E partendo da questi ragionamenti non è che poi finiamo per dare fuoco ai barboni perché disturbano l'estetica del tessuto urbano?
Ma sì dai, evitiamo di guardare i quadri di Hieronymus Bosch perché sono pieni di gente orrendamente ritratta! E nascondiamo alla vista le orrende caricature di Leonardo da Vinci perché non ritraggono persone belle.
Ma la Arcuri è solo provvisoriamente bella, quando avrà 60 anni non sarà più così ben guardabile. E se è vero che la bellezza salverà il mondo, come disse il principe Mi?kin nell'Idiota di Dostoevskij, non è che possiamo lasciare al gusto di una persona sola la definizione di bellezza, non possiamo permetterci di individuare la bellezza solo in ciò che ci fa arrapare oggi.
Top
Profilo Invia messaggio privato HomePage
Proserpina
Moderatore Sessualità
Moderatore Sessualità


Registrato: 08/10/07 14:22
Messaggi: 4599
Residenza: Sono solo nella tua mente (by Odos)

MessaggioInviato: 06 Mag 2009 12:15    Oggetto: Rispondi citando

Nessuno ha il diritto di limitare l'altrui libertà di espressione mentale, corporea, sessuale soprattutto se avviene nel proprio privato.
Gli americani non sanno più cosa inventarsi per reprimere qualsiasi cosa abbia l'odore, il sapore e il colore della diversità...

Alla faccia della democrazia.


L'ultima modifica di Proserpina il 06 Mag 2009 15:05, modificato 1 volta
Top
Profilo Invia messaggio privato HomePage
Emmett Brown
Dio maturo
Dio maturo


Registrato: 28/09/05 00:41
Messaggi: 1295

MessaggioInviato: 06 Mag 2009 12:58    Oggetto: Rispondi citando

Vista e gusto nelle fotografie? C'è più bellezza nella foto che illustra questo articolo che in un calendario della Arcuri.
Top
Profilo Invia messaggio privato
mariantonio.inter
Semidio
Semidio


Registrato: 02/06/07 14:56
Messaggi: 478
Residenza: meglio nero che bianconero ! NO al razzimo

MessaggioInviato: 06 Mag 2009 13:58    Oggetto: Rispondi citando

Caro silent runner, bene, bene... ho visto che la arcuri (UNA DELLE TANTE BELLE RAGAZZE DEL SUD D'ITALIA) ha smosso indignazione tra gli scriventi. Sarà mica che il paese che le ha dedicato un momumento ha i cittadini dei co........?
Comunque io mi riferivo alla Arcuri perchè proprio ieri ho visto su google un'intervista: resta che è una gran bella donna..
Specificato questo, la tua risposta risposta alla mia è gradita ma non è il terreno su cui voglio misurarmi: probabilmente non ne ho la cultura. Secondo me però hai sconfinato nella psicanalisi attraverso la quale si arriva solo a dire che tutto è possibile e tutto e interpretabile in maniera personale (quindi una cosa vista da 6.000000000 di persone ha 6.000000000 di punti di vista diversi).
Per questo motivo non voglio "darti corda" su disabili, brutti ecc. perchè secondo me non fa parte del concetto che volevo esprimere.
Ripeto, la natura nel dna, per motivi di trasmissione di geni, ci ha dato la possibilità di distinguere il buono dal cattivo, il brutto dal bello esattamente come normalmente succede nel mondo animale (e noi siamo degli animali anche se intelligenti). Certo, poi la cultura ha "inquinato" questo sentire del tutto naturale (scritto nel ns. dna), ma questo è un altroenorme discorso da dipanare.
Per questo ritorno ad affermare che, supportato dal mio essere parte integrante del mondo animale, preferisco un nudo giovane (indifferentemente se maschio o femmina) ad un nudo attempato (mi astengo dire vecchio altrimenti sarei sommerso dalle critiche di qualche ben pensante che sicuramente se è sollazzato qualche volta nella sua vita a vedere, magari casualmente, una rivista o un film porno!!).
grazie e ciao
Top
Profilo Invia messaggio privato
Proserpina
Moderatore Sessualità
Moderatore Sessualità


Registrato: 08/10/07 14:22
Messaggi: 4599
Residenza: Sono solo nella tua mente (by Odos)

MessaggioInviato: 06 Mag 2009 14:57    Oggetto: Rispondi citando

Emmett Brown ha scritto:
Vista e gusto nelle fotografie? C'è più bellezza nella foto che illustra questo articolo che in un calendario della Arcuri.


vista e gusto nella sessualità anche di persone ultressantenni. Non c'è età per il piacere.

Pochi giorni fa ho spiegato ad una donna di 58 anni dov'era il suo clitoride.
Mi ha ringraziata commossa: ha un partner di 68 anni che le ha fatto venire voglia di scoprire il suo corpo.
Top
Profilo Invia messaggio privato HomePage
Proserpina
Moderatore Sessualità
Moderatore Sessualità


Registrato: 08/10/07 14:22
Messaggi: 4599
Residenza: Sono solo nella tua mente (by Odos)

MessaggioInviato: 06 Mag 2009 15:02    Oggetto: Rispondi citando

mariantonio.inter ha scritto:


Per questo ritorno ad affermare che, supportato dal mio essere parte integrante del mondo animale, preferisco un nudo giovane (indifferentemente se maschio o femmina) ad un nudo attempato (mi astengo dire vecchio altrimenti sarei sommerso dalle critiche di qualche ben pensante che sicuramente se è sollazzato qualche volta nella sua vita a vedere, magari casualmente, una rivista o un film porno!!).
grazie e ciao


Bene, non è però questo il punto. Qui si parla di sessualità fra persone anziane alle quali va di filmarsi. Saranno pur libere di farlo?


Un pizzico di malizia femmilile:
...che effetto ti fa pensare che anche le donne preferiscono un nudo giovanile al tuo?
Top
Profilo Invia messaggio privato HomePage
Proserpina
Moderatore Sessualità
Moderatore Sessualità


Registrato: 08/10/07 14:22
Messaggi: 4599
Residenza: Sono solo nella tua mente (by Odos)

MessaggioInviato: 06 Mag 2009 15:12    Oggetto: Re: né censura, né incompetenza, né leggerezza ma protezione Rispondi citando

mariantonio.inter ha scritto:

Quindi non condivido la conclusione dell'articolo: nè censura, nè incompetenza, nè leggerezza ma solo il proteggere una fascia che, e qui siamo tutti d'accordo, è, assieme ai bambini, la più debole.
saluti


Ai bambini fa molto più male vedere i genitori scannarsi per dividersi la casa e i beni. E nessuno li protegge dell'immaturità degli adulti che vivono accanto a loro.
Top
Profilo Invia messaggio privato HomePage
Silent Runner
Supervisor sezione Chiacchiere a 360°
Supervisor sezione Chiacchiere a 360°


Registrato: 16/05/05 09:17
Messaggi: 20629
Residenza: Pianeta Terra

MessaggioInviato: 06 Mag 2009 16:09    Oggetto: Elogio dell'intolleranza estetica verso il vecchio? Rispondi citando

mariantonio.inter ha scritto:
Caro silent runner, bene, bene... ho visto che la arcuri (UNA DELLE TANTE BELLE RAGAZZE DEL SUD D'ITALIA) ha smosso indignazione tra gli scriventi. Sarà mica che il paese che le ha dedicato un momumento ha i cittadini dei co........?
Indignazione? E per cosa? Per la Arcuri, una persona che ha la stessa espressività di una triglia lessa? Non mi sono affatto indignato, ho solo usato un pizzico d'ironia. Sappi però che dedicare un monumento ad una soubrette che non ha particolari meriti artistici non è necessariamente un indice di intelligenza o di coglionaggine, è solo espressione della voglia tutta maschile di circondarsi di icone femminili vista la difficoltà di relazionare con le femmine vere. Twisted Evil

mariantonio.inter ha scritto:

Comunque io mi riferivo alla Arcuri perchè proprio ieri ho visto su google un'intervista: resta che è una gran bella donna..

Tante grazie! Volevi che facessero un monumento ad una brutta soubrette? Help

mariantonio.inter ha scritto:

Specificato questo, la tua risposta risposta alla mia è gradita ma non è il terreno su cui voglio misurarmi: probabilmente non ne ho la cultura.
Oddio noooo! Non nascondetevi dietro questo orribile Moloch della cultura, non è la cultura a darmi ragione sulle cose o a farmi vincere in una discussione anche perché le discussioni servono ad esporre le idee perché gli altri le possano discutere insieme a noi, non a far vincere loro un concorso di bellezza. Ma che cosa avete tutti contro la cultura? Non è altro che il risultato della conoscenza. Santo cielo! Rolling Eyes

mariantonio.inter ha scritto:

Secondo me però hai sconfinato nella psicanalisi attraverso la quale si arriva solo a dire che tutto è possibile e tutto e interpretabile in maniera personale (quindi una cosa vista da 6.000000000 di persone ha 6.000000000 di punti di vista diversi).

Nnnooooo! Anche la psicanalisi! La psicanalisi noooooo! Help Ho solo espresso qualche opinione perfettamente discutibile. Però scusa, non liquidiamo la psicanalisi con tanta leggerezza. A parte alcune madornali cantonate è stata, dopo la filosofia dei primordi, l'unico progetto di indagine sull'origine del comportamento umano, dove è così ben evidente la presenza di sottostrutture più o meno consapevoli che sono all'origine delle strategie comportamentali dei singoli e delle masse, ben al di là dei meccanismi istintuali generati dal nostro sistema limbico (la parte più primitiva del nostro cervello, quella parte che ultimamente semba aver preso il sopravvento sulla ragione). :whink:

mariantonio.inter ha scritto:

Per questo motivo non voglio "darti corda" su disabili, brutti ecc. perchè secondo me non fa parte del concetto che volevo esprimere.
Ma certo, lo immagino. Però dal momento che siamo tutti responsabili di quel che scriviamo devo ricordarti che la parte che concerne la succitata Manuelona Arcuri l'avevi portata come esempio da anteporre alle immagini di anziani e non come sottobicchiere. Ironico
Mi hai perciò dato lo spunto per ribadire un concetto che mi è molto caro. La bellezza salverà il mondo... sì, d'accordo, ma non esageriamo nel dare valore all'estetica e nel ridurre la realtà a pochi simboli o modelli peraltro inadeguati alla complessità di questo mondo articolato.
Te lo immagineresti un campionato di calcio che, come gocatori in campo mettesse tutti Maradona? Senza le persone normali, belli meno belli, gente così così e gente bellissima, questo mondo sarebbe solo un gigantesco calendario con figure a due dimensioni. In questo mondo, amico mio, esistono anche anziani... Se ci pensi bene, visto l'innalzarsi della vita media possiamo dire con una certa tranquillità che gli anziani siano il futuro del mondo! Togliere loro il diritto alla normalità rinchiudendoli dietro gabbie ideologiche che li fa asessuati e sgradevoli alla vista è a mio avviso una abominazione minore ma pur sempre una abominazione che, disgraziatamente mi ricorda qualcosa di terribile accaduto nella prima metà del novecento.

mariantonio.inter ha scritto:
Ripeto, la natura nel dna, per motivi di trasmissione di geni, ci ha dato la possibilità di distinguere il buono dal cattivo, il brutto dal bello esattamente come normalmente succede nel mondo animale (e noi siamo degli animali anche se intelligenti). Certo, poi la cultura ha "inquinato" questo sentire del tutto naturale (scritto nel ns. dna), ma questo è un altro enorme discorso da dipanare.
DNA? Ti riferisci a questo? "GACTTACTAGATCACAGATTACATTACAGTTACAGATTACATAG" e cioè, "guanina- adenina- citosina- timina- timina- adenina- citosina- timina- adenina- guanina- adenina- timina- citosina- adenina- citosina- adenina-guanina- adenina- timina- timina- adenina- citosina- adenina- timina- timina- adenina- citosina- adenina-guanina- timina- timina- adenina- citosina- adenina- guanina- adenina- timina- timina- adenina- citosina- adenina- timina- adenina- guanina"? Non scherziamo con il DNA, per favore. Non è questo che ci ha resi quello che siamo! Se noi umani, noi homo sapiens siamo diventati sapiens è soprattutto una questione epigenetica. Sono state le interazioni culturali e ambientali a renderci così bravi a creare un mondo adatto a noi, anche se, per fare questo, abbiamo alterato l'ambiente nel quale viviamo e dal quale dipendiamo.

mariantonio.inter ha scritto:
Per questo ritorno ad affermare che, supportato dal mio essere parte integrante del mondo animale, preferisco un nudo giovane (indifferentemente se maschio o femmina) ad un nudo attempato (mi astengo dire vecchio altrimenti sarei sommerso dalle critiche di qualche ben pensante che sicuramente se è sollazzato qualche volta nella sua vita a vedere, magari casualmente, una rivista o un film porno!!).
grazie e ciao
Ma cerrrrrrrrto! E chi te lo nega? Very Happy Poi preparati a far parte, se sei fortunato, ad appartenere alla categoria che adesso snobbi. ...Se invece non sei fortunato sarà solo perché, disgraziatamente muori giovane (l'unica alternativa all'invecchiamento è morire giovani). Usa perciò tutte le parole che vuoi, vecchio va benissimo. Non siamo così politically correct e io non sono un benpensante, perciò non ti sommergerò di critiche nemmeno se me le chiedi come un favore. Se rispondo alle tue osservazioni è solo perché sono interessati e pericolose quanto le mie. Interessanti perché appartengono ad un pensare comune che sta riemergendo con una certa frequenza nei media e riproposto come pensiero corrente, con un sottotitolo che dice: "Se tutti la pensano così vuol dire che è vero". Anche se non è affatto vero che la maggioranza abbia necessariamente ragione solo perché è la maggioranza.. Al massimo la maggioranza si può accontentare del potere che gli viene concesso. Pericolose per le stesse ragioni di cui sopra.

..Non lo hai detto? Lo so. Ma sai quanti, davanti al tuo esprimere queste idee vi hanno apposto o riconosciuto questa omologazione?

Coraggio! Sono solo opinioni! Wink
Top
Profilo Invia messaggio privato HomePage
freemind
Supervisor sezione Programmazione
Supervisor sezione Programmazione


Registrato: 04/04/07 20:28
Messaggi: 4643
Residenza: Internet

MessaggioInviato: 06 Mag 2009 17:58    Oggetto: Rispondi citando

Si è partiti con il vedere la pedofilia anche dove non c'è e si è arrivati ad impedire a due che vanno a letto insieme di fare qualche gioco con la macchina fotografica se hanno più di 60 anni!

Non è che tutti gli sfigati che si inventano queste cose trombano un po' troppo poco?
Mah, il dubbio mi è venuto da un po' e questa notizia lo alimenta ancora di più!

Che cosa c'è di male nel sesso, sia con che senza amore?

Quando le persone si divertono e non hanno problemi allora hanno la testa che può funzionare, se la testa funziona il controllo non è possibile e se il controllo non è possibile allora non possono fotterci!

Il mondo sta andando a finire male...
Top
Profilo Invia messaggio privato
Proserpina
Moderatore Sessualità
Moderatore Sessualità


Registrato: 08/10/07 14:22
Messaggi: 4599
Residenza: Sono solo nella tua mente (by Odos)

MessaggioInviato: 06 Mag 2009 21:51    Oggetto: Rispondi citando

freemind ha scritto:


Che cosa c'è di male nel sesso, sia con che senza amore?




e sempre a questa domanda primordiale approdiamo.. 8)
Top
Profilo Invia messaggio privato HomePage
merlin
Dio maturo
Dio maturo


Registrato: 15/03/07 23:32
Messaggi: 2421
Residenza: Kingdom of Camelot

MessaggioInviato: 06 Mag 2009 22:09    Oggetto: Rispondi citando

Proserpina ha scritto:
[...]
Pochi giorni fa ho spiegato ad una donna di 58 anni dov'era il suo clitoride.
Mi ha ringraziata commossa: ha un partner di 68 anni che le ha fatto venire voglia di scoprire il suo corpo.

Bah! Ho il dubbio che implicitamente non sia un gran complimento per il partner 68nn; e per almeno un paio di motivi! Wink allespalle
Top
Profilo Invia messaggio privato
Emmett Brown
Dio maturo
Dio maturo


Registrato: 28/09/05 00:41
Messaggi: 1295

MessaggioInviato: 06 Mag 2009 22:58    Oggetto: Due o tre cose. Rispondi citando

Silent Runner ha scritto:
...la Arcuri, una persona che ha la stessa espressività di una triglia lessa?

Io non la conosco personalmente ma mi dicono che contrariamente alle apparenze d'immagine sia una bella persona, una buona compagnia, insomma un tipo interessante ed espressivo almeno quanto noi ...ma abbastanza intelligente da farsi pubblicare in due sole dimensioni e con certe espressioni da triglia lessa, come il mercato vuole. (No, non chiedetemi il suo numero, non posso, dai, non sta bene, non si fa).

@freemind: sei appena diventato mio amico. Cazzi tuoi.

Volete conoscere il mio minuscolissimo punto di vista diretto sulla morale statunitense?

A) 2001, primavera. Le Torri sono ancora in piedi. Io con mia figlia di 14 anni e una quindicina di 'colleghi piloti', una settimana in Florida e NY. In un Ponderosa Steackhouse, che vi consiglio, dove si mangia e si beve a volontà e bene, una sera ordino tra l'altro due birre. Due birre per me, perchè ci siamo già stati e so che sono davvero piccole, sono bicchieri, uno solo mi lascia insoddisfatto. Mia figlia, come me, spillerà a volontà ettolitri di bevande analcooliche a disposizione come tanto altro. Bene, due birre non me le volevano dare perchè ero con una minore. Alle mie spiegazioni che non erano per noi due ma per me solo me le hanno date, ma sono stato guardato a vista da una cameriera appositamente incaricata finchè non mi sono bevuto personalmente entrambi i bicchieri (e ho accelerato la cosa per porre fine all'imbarazzante situazione).

B) Stesso periodo, Newark (aeroporto nei pressi della Grande Mela, un posto come potrebbe essere Malpensa per Milano). Disguido di voli e pernottamento obbligato in un hotel di classe media. Gruppo formato da una quindicina di persone, per lo più maschi adulti, dall'aspetto non necessariamente splendido vista la situazione. Qualcuno era davvero poco rassicurante... E poi non era neppure un vero gruppo gestito come tale, era solo un certo numero di persone nello stesso posto. Ci eravamo arrivati per i fatti nostri, nessuna organizzazione. Donne, solo una figlia grande di uno, l'amica/amante di un altro e mia figlia, minorenne. Non hanno chiesto i documenti a nessuno, neanche il nome, solo 90 dollari a camera, e io ho passato la notte con una minore che poteva essere chiunque.

C) Una mia conoscente italiana ha figli e nipoti che vivono a NY, coniugati e naturalizzati ormai statunitensi. Là loro hanno parenti acquisiti del tutto americani 'originali'. Bene, un bel giorno di pochi anni fa questa signora ha spedito loro in una busta le foto scattate in spiaggia ad altri suoi nipoti che vivono in Italia. Non l'avesse mai fatto! I parenti d'oltreoceano (che non mi risulta siamo quaccheri, anzi) si sono vivamente scandalizzati per questa perversione nonnesca, sono rimasti turbati e risentiti in quanto le foto ritraggono i bimbi mentre fanno i castelli di sabbia col costumino, e la nipotina di 4 (quattro) anni non indossa il pezzo di sopra ma solo le mutandine. Questa me la sono fatta ripetere due o tre volte perchè non la volevo credere, e ve la passo così com'è.

Ditemi voi se non dobbiamo metterci una tonnellata di tara, quando commentiamo fatti di morale (soprattutto sessuale) ambientati in USA. Io quasi quasi come italiano mi consolo.
Top
Profilo Invia messaggio privato
Proserpina
Moderatore Sessualità
Moderatore Sessualità


Registrato: 08/10/07 14:22
Messaggi: 4599
Residenza: Sono solo nella tua mente (by Odos)

MessaggioInviato: 06 Mag 2009 23:34    Oggetto: Rispondi

merlin ha scritto:
Proserpina ha scritto:
[...]
Pochi giorni fa ho spiegato ad una donna di 58 anni dov'era il suo clitoride.
Mi ha ringraziata commossa: ha un partner di 68 anni che le ha fatto venire voglia di scoprire il suo corpo.

Bah! Ho il dubbio che implicitamente non sia un gran complimento per il partner 68nn; e per almeno un paio di motivi! Wink allespalle


Non lo è per il marito che ha avuto per 30 anni! Very Happy Very Happy Very Happy

Con il sessantotenne ci ha passato solo una notte...diamogli il tempo di cercarlo. Twisted Evil
Top
Profilo Invia messaggio privato HomePage
Mostra prima i messaggi di:   
Nuovo argomento   Rispondi    Indice del forum -> Sessualità e cultura Tutti i fusi orari sono GMT + 1 ora
Vai a 1, 2  Successivo
Pagina 1 di 2

 
Vai a:  
Non puoi inserire nuovi argomenti
Non puoi rispondere a nessun argomento
Non puoi modificare i tuoi messaggi
Non puoi cancellare i tuoi messaggi
Non puoi votare nei sondaggi